| Detail of EST/Unigene AW257126 |
| Acc. | AW257126 |
| Internal Acc. | EST305263 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Nicotiana tabacum E-value=2e-13; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH3 OS=Arabidopsis thaliana E-value=9e-10; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Arabidopsis thaliana E-value=4e-09; Putative histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH10 OS=Arabidopsis thaliana E-value=3e-06; |
| Length | 158 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | AAAACAGGGGTTTTATTGCCCGATCTTACTTCCGGGGCTGAAAAAGTCCCTGTTTGTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843641 |
| Trichome-related Gene from Literature | N/A |