| Detail of EST/Unigene AW257198 |
| Acc. | AW257198 |
| Internal Acc. | EST305335 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histone acetyltransferase HAC12 OS=Arabidopsis thaliana E-value=8e-31; Histone acetyltransferase HAC1 OS=Arabidopsis thaliana E-value=2e-30; Histone acetyltransferase HAC2 OS=Arabidopsis thaliana E-value=3e-30; Probable histone acetyltransferase HAC-like 1 OS=Oryza sativa subsp. japonica E-value=6e-29; Histone acetyltransferase HAC5 OS=Arabidopsis thaliana E-value=4e-27; |
| Length | 664 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | GTGGGAGGAGAAACCTTAAAATTCAACTGCGGGCGACAACAACACATGTCAATAACTGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04498 E1A/CREB-binding protein |
| EC | 2.3.1.48 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838242 |
| Trichome-related Gene from Literature | N/A |