Detail of EST/Unigene AW257334 |
Acc. | AW257334 |
Internal Acc. | EST305471 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-35; Cytochrome P450 83A1 OS=Arabidopsis thaliana E-value=2e-33; Cytochrome P450 71A1 OS=Persea americana E-value=2e-31; Cytochrome P450 71B10 OS=Arabidopsis thaliana E-value=4e-30; Cytochrome P450 71B23 OS=Arabidopsis thaliana E-value=6e-30; |
Length | 643 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | AACTTTCCTCTTATTCATTTTCTTAGTGTCAAAAGAGTCTCAATGTTTTACTCAGTTAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |