Detail of EST/Unigene AW257394 |
Acc. | AW257394 |
Internal Acc. | EST305531 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 47 OS=Arabidopsis thaliana E-value=2e-90; Beta-glucosidase 45 OS=Arabidopsis thaliana E-value=4e-83; Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=6e-81; Probable inactive beta-glucosidase 14 OS=Oryza sativa subsp. japonica E-value=6e-81; Beta-glucosidase 18 OS=Oryza sativa subsp. japonica E-value=1e-78; |
Length | 691 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | TGGTCTCAATTACTATAACAGGCTAATTGACGCACTTGTCGATAAAGGAATAGATCCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828264 |
Trichome-related Gene from Literature | N/A |