Detail of EST/Unigene AW257401 |
Acc. | AW257401 |
Internal Acc. | EST305538 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative aconitate hydratase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=0; Aconitate hydratase, cytoplasmic OS=Cucurbita maxima E-value=5e-99; Aconitate hydratase, cytoplasmic (Fragment) OS=Solanum tuberosum E-value=2e-98; Aconitate hydratase 1 OS=Arabidopsis thaliana E-value=4e-97; Aconitate hydratase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-95; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | TCCAGTGAAGAAATAGCAGATGTTGTACAATCGAGTGTGCTGCCCGATTTGTTTAGGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
EC | 4.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829737 |
Trichome-related Gene from Literature | N/A |