Detail of EST/Unigene AW257416 |
Acc. | AW257416 |
Internal Acc. | EST305553 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UTP--glucose-1-phosphate uridylyltransferase OS=Astragalus penduliflorus E-value=1e-96; UTP--glucose-1-phosphate uridylyltransferase OS=Pyrus pyrifolia E-value=1e-88; UTP--glucose-1-phosphate uridylyltransferase OS=Musa acuminata E-value=2e-86; UTP--glucose-1-phosphate uridylyltransferase OS=Solanum tuberosum E-value=9e-86; UTP--glucose-1-phosphate uridylyltransferase OS=Hordeum vulgare E-value=2e-85; |
Length | 728 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | GGTTCATTCATCACCTTCTTCTCGCTCTCTTCTCTCCACACACACATTTGCATCTTCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase |
EC | 2.7.7.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831596 |
Trichome-related Gene from Literature | N/A |