Detail of EST/Unigene AW257442 |
Acc. | AW257442 |
Internal Acc. | EST305579 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=1e-20; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=2e-19; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=6e-19; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=2e-18; Cytochrome P450 71A23 OS=Arabidopsis thaliana E-value=3e-18; |
Length | 555 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | CACTAGGGATGCTTATAAAGTCGGTTGATAAAGCAGCGGTTTTAGGTGAAGTCGTGAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |