Detail of EST/Unigene AW257463 |
Acc. | AW257463 |
Internal Acc. | EST305600 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=6e-59; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=8e-56; Lichenase OS=Nicotiana plumbaginifolia E-value=3e-54; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=3e-54; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-54; |
Length | 655 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | GAAACTCTTCGATTGATCATGTCTATCATTTTTCTGCTTGTTGGTATACTGTCCATTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |