| Detail of EST/Unigene AW267905 |
| Acc. | AW267905 |
| Internal Acc. | EST306247 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Formimidoyltransferase-cyclodeaminase OS=Sus scrofa E-value=1e-06; Formimidoyltransferase-cyclodeaminase OS=Dictyostelium discoideum E-value=9e-06; |
| Length | 623 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | TTTCAATTATACTACTACTACCAAGGAGCAAAAGAAAACGGTAGACCAATCCATGTTGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K01746 formiminotetrahydrofolate cyclodeaminase |
| EC | 2.1.2.5 4.3.1.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816615 |
| Trichome-related Gene from Literature | N/A |