Detail of EST/Unigene AW287874 |
Acc. | AW287874 |
Internal Acc. | N100718e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-16; Ferritin-3, chloroplastic OS=Glycine max E-value=2e-16; Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=9e-16; Ferritin-4, chloroplastic OS=Glycine max E-value=2e-15; Ferritin-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-14; |
Length | 440 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | GGAAAGTGAGTTTTTGGGTGAACAGGTGGAAGCCATAAAAAAAATATCCGAGTATGTTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820276 |
Trichome-related Gene from Literature | N/A |