Detail of EST/Unigene AW287928 |
Acc. | AW287928 |
Internal Acc. | N100772e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=2e-35; Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=7e-17; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=2e-16; Probable NAD(P)H-dependent oxidoreductase 1 OS=Oryza sativa subsp. japonica E-value=2e-16; NADPH-dependent codeinone reductase 1-5 OS=Papaver somniferum E-value=2e-16; |
Length | 403 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | GTTATGGAGAATGATATGCTTAAAGAGATTGCAGATGCACATGGAAAGTCTGTTGCACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00251 3-oxo-5beta-steroid 4-dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00251 3-oxo-5beta-steroid 4-dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00251 3-oxo-5beta-steroid 4-dehydrogenase |
EC | 1.1.1.2 1.3.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842289 |
Trichome-related Gene from Literature | N/A |