| Detail of EST/Unigene AW288016 |
| Acc. | AW288016 |
| Internal Acc. | N100860e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid cleavage dioxygenase 8, chloroplastic OS=Arabidopsis thaliana E-value=4e-45; Beta,beta-carotene 9',10'-oxygenase OS=Homo sapiens E-value=2e-17; Beta,beta-carotene 9',10'-oxygenase OS=Macaca fascicularis E-value=3e-17; Beta,beta-carotene 9',10'-oxygenase OS=Mus musculus E-value=6e-17; Beta,beta-carotene 9',10'-oxygenase OS=Pongo abelii E-value=1e-16; |
| Length | 535 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS; |
| Sequence | ATATGCCTATGCTTGTGGAGCACAGCGCCCTTGTAACTTCCCCAACACCCTCACCAAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.99.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829417 |
| Trichome-related Gene from Literature | 829417 |