Detail of EST/Unigene AW288039 |
Acc. | AW288039 |
Internal Acc. | N100883e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thermospermine synthase ACAULIS5 OS=Arabidopsis thaliana E-value=1e-60; Spermidine synthase OS=Thermoanaerobacter sp. (strain X514) E-value=3e-29; Spermidine synthase OS=Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E) E-value=3e-29; Spermidine synthase 1 OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) E-value=1e-28; Spermidine synthase OS=Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903) E-value=7e-28; |
Length | 510 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | TGGATCCCCCGGGCTGCAGGCAGAAATGTTTTACGTTAACGGGTTTGCAAAGGTTGTCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832073 |
Trichome-related Gene from Literature | N/A |