| Detail of EST/Unigene AW299035 |
| Acc. | AW299035 |
| Internal Acc. | EST305709 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoinositide phospholipase C 6 OS=Arabidopsis thaliana E-value=5e-44; Phosphoinositide phospholipase C 5 OS=Arabidopsis thaliana E-value=4e-43; Phosphoinositide phospholipase C 4 OS=Arabidopsis thaliana E-value=1e-41; Phosphoinositide phospholipase C 7 OS=Arabidopsis thaliana E-value=2e-30; Phosphoinositide phospholipase C 2 OS=Arabidopsis thaliana E-value=3e-30; |
| Length | 632 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | ATGATGAGATAGGATGGACTTGATACACAGAAGGTGGTGGAGGAAGTGTTGCAGAAGCGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K05857 phospholipase C, delta; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05857 phospholipase C, delta; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K05857 phospholipase C, delta |
| EC | 3.1.4.11 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818602 |
| Trichome-related Gene from Literature | N/A |