Detail of EST/Unigene AW299048 |
Acc. | AW299048 |
Internal Acc. | EST305722 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=4e-58; Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=1e-57; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-54; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=3e-53; Elongation factor Ts, mitochondrial OS=Zea mays E-value=8e-53; |
Length | 729 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2; |
Sequence | GTATTGTTTGTTATCACTCCAGTTATCCAACTTTATCTCATAGATCTTCAACACGTGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826713 |
Trichome-related Gene from Literature | N/A |