| Detail of EST/Unigene AW299048 |
| Acc. | AW299048 |
| Internal Acc. | EST305722 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=4e-58; Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=1e-57; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-54; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=3e-53; Elongation factor Ts, mitochondrial OS=Zea mays E-value=8e-53; |
| Length | 729 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | GTATTGTTTGTTATCACTCCAGTTATCCAACTTTATCTCATAGATCTTCAACACGTGGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826713 |
| Trichome-related Gene from Literature | N/A |