Detail of EST/Unigene AW329226 |
Acc. | AW329226 |
Internal Acc. | N200438e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=7e-39; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-31; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-19; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=7e-18; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=2e-17; |
Length | 588 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | GCCAAACAGGAGGTTTGAGACTTTTCTTTTTGCTTTGTTTAACGAGAATCAGAAACCTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824709 |
Trichome-related Gene from Literature | N/A |