Detail of EST/Unigene AW329425 |
Acc. | AW329425 |
Internal Acc. | N200660e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 3 OS=Arabidopsis thaliana E-value=4e-49; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=4e-44; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=1e-43; Mitogen-activated protein kinase 5 OS=Oryza sativa subsp. japonica E-value=7e-43; Mitogen-activated protein kinase 5 OS=Oryza sativa subsp. indica E-value=7e-43; |
Length | 567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | AATGCGCTTATTGACAGAGCTTCTTGGCACTCCAACTGACGCTGATGTGGGGTTAGTAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
EC | 2.7.11.24 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823706 |
Trichome-related Gene from Literature | N/A |