| Detail of EST/Unigene AW329436 |
| Acc. | AW329436 |
| Internal Acc. | N200671e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acylpyruvase FAHD1, mitochondrial OS=Dictyostelium discoideum E-value=1e-40; Acylpyruvase FAHD1, mitochondrial OS=Bos taurus E-value=2e-35; Uncharacterized protein ZK688.3 OS=Caenorhabditis elegans E-value=4e-35; Acylpyruvase FAHD1, mitochondrial OS=Homo sapiens E-value=2e-33; Acylpyruvase FAHD1, mitochondrial OS=Pongo abelii E-value=4e-33; |
| Length | 442 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS; |
| Sequence | TTCGGCACCAGGAGAAATGTCGACGGCGTCTTCCTGTCAGAAACTCTTTGATTTAGGCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827276 |
| Trichome-related Gene from Literature | N/A |