| Detail of EST/Unigene AW329800 |
| Acc. | AW329800 |
| Internal Acc. | N201072e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase small chain OS=Nicotiana tabacum E-value=2e-36; Ribonucleoside-diphosphate reductase small chain C OS=Arabidopsis thaliana E-value=5e-35; Putative ribonucleoside-diphosphate reductase small chain B OS=Arabidopsis thaliana E-value=1e-34; Ribonucleoside-diphosphate reductase subunit M2 OS=Rattus norvegicus E-value=1e-29; Ribonucleoside-diphosphate reductase subunit M2 OS=Danio rerio E-value=1e-29; |
| Length | 322 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS; |
| Sequence | CTAAAATCTCTTCCTTCTCAAATAATCACTATTTTCATAATCACTTTTTTCTCTCAATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
| EC | 1.17.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822324 |
| Trichome-related Gene from Literature | N/A |