Detail of EST/Unigene AW432173 |
Acc. | AW432173 |
Internal Acc. | T210222e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Arabidopsis thaliana E-value=1e-25; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-25; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-15; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Dictyostelium discoideum E-value=5e-15; Ubiquinone/menaquinone biosynthesis methyltransferase ubiE OS=Rhizobium loti (strain MAFF303099) E-value=4e-14; |
Length | 365 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | ACCCTCTACGCTTCCGTGTGGCAAACACACACACCCCTCTCTTCTTCTCTCCCCTCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Cofactors and Vitamins > ko00130 Ubiquinone biosynthesis > K06127 ubiquinone biosynthesis methyltransferase |
EC | 2.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835835 |
Trichome-related Gene from Literature | N/A |