Detail of EST/Unigene AW559313 |
Acc. | AW559313 |
Internal Acc. | EST306356 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L2, chloroplastic OS=Vitis vinifera E-value=2e-34; 50S ribosomal protein L2, chloroplastic OS=Panax ginseng E-value=2e-34; 50S ribosomal protein L2, chloroplastic OS=Daucus carota E-value=2e-34; 50S ribosomal protein L2, chloroplastic OS=Cucumis sativus E-value=2e-34; 50S ribosomal protein L2, chloroplastic OS=Citrus sinensis E-value=2e-34; |
Length | 506 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | CCAGAGGAATCATTACCGCAGGGCATAGTTGGGGAGGTNCATAAGCGTCTATCCCCGCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |