Detail of EST/Unigene AW559375 |
Acc. | AW559375 |
Internal Acc. | EST314423 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 3, mitochondrial OS=Glycine max E-value=1e-74; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=2e-51; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=4e-50; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=7e-43; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=7e-40; |
Length | 535 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | CATGAGAAACATTTTATTAAGGTCAACTGCACGAGCTTTGTTCCGCAATGGTGGGAACTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |