| Detail of EST/Unigene AW559376 |
| Acc. | AW559376 |
| Internal Acc. | EST314424 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 93A3 OS=Glycine max E-value=4e-51; Cytochrome P450 93A1 OS=Glycine max E-value=6e-50; Cytochrome P450 93A2 OS=Glycine max E-value=3e-44; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=9e-44; Licodione synthase OS=Glycyrrhiza echinata E-value=6e-39; |
| Length | 636 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | CTAGCTTCTTTCCTCTTGTTAAGATTGATCTTCACCATCAAGTTCCACCAGAAATCACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830580 |
| Trichome-related Gene from Literature | N/A |