| Detail of EST/Unigene AW559418 |
| Acc. | AW559418 |
| Internal Acc. | EST314466 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase OS=Glycine max E-value=7e-94; Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=4e-89; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=2e-87; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=2e-85; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=5e-84; |
| Length | 737 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | GCAACCAGACTCTGAATTACAAACTTGGTGGAAGGAAGTTGTAGAAAAAGGTCATGGTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; |
| EC | 1.13.11.31 1.13.11.33 1.13.11.34 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841944 |
| Trichome-related Gene from Literature | 841944 |