| Detail of EST/Unigene AW559727 |
| Acc. | AW559727 |
| Internal Acc. | EST314719 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-27; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-27; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=6e-27; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-26; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=4e-26; |
| Length | 473 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | ATGCCAATCCTTTGGTCATGTAATCAAGTCAATCACAAGGGTAATTCTTTTCCCCTATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836838 |
| Trichome-related Gene from Literature | N/A |