| Detail of EST/Unigene AW559816 |
| Acc. | AW559816 |
| Internal Acc. | EST314864 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D6 OS=Solanum chacoense E-value=2e-30; Cytochrome P450 71A1 OS=Persea americana E-value=4e-30; Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=1e-29; Cytochrome P450 71B35 OS=Arabidopsis thaliana E-value=1e-29; Cytochrome P450 71D7 OS=Solanum chacoense E-value=3e-29; |
| Length | 505 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | AACACAAAACATCTAAGAAATCAACAACTCTCCACCTGTCCTAAATGTCTTCCTTTCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K01832 cytochrome P450, family 5, subfamily A (thromboxane-A synthase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
| EC | 1.14.14.1 5.3.99.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822234 |
| Trichome-related Gene from Literature | N/A |