| Detail of EST/Unigene AW560576 |
| Acc. | AW560576 |
| Internal Acc. | EST315624 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-2, chloroplastic OS=Nicotiana tabacum E-value=2e-33; Hexokinase-4, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-28; Hexokinase-9 OS=Oryza sativa subsp. japonica E-value=5e-26; Hexokinase-1 OS=Arabidopsis thaliana E-value=4e-25; Hexokinase-1 OS=Spinacia oleracea E-value=2e-24; |
| Length | 304 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | AACGAGATTATTAACGAAACTCAAACAAGACTGTGCAACTCCTCTACCTCTTCTTCACCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
| EC | 2.7.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829034 |
| Trichome-related Gene from Literature | 829034 |