Detail of EST/Unigene AW560596 |
Acc. | AW560596 |
Internal Acc. | EST315644 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=4e-56; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=8e-55; 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=3e-54; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=2e-32; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=8e-31; |
Length | 496 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | AATTCAGTTACTTCGGCTCATCATTCCACTCATCTCTCTGCTTCATTATGTTCTGCTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839434 |
Trichome-related Gene from Literature | N/A |