| Detail of EST/Unigene AW560625 |
| Acc. | AW560625 |
| Internal Acc. | EST315673 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=8e-13; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=3e-12; Beta-fructofuranosidase, cell wall isozyme OS=Zea mays E-value=2e-11; Beta-fructofuranosidase, insoluble isoenzyme 4 OS=Oryza sativa subsp. japonica E-value=3e-11; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=5e-11; |
| Length | 374 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | AATAATTATTTGTTACTTATCAATTATTGAATGAATGTTGACTTATCAATCCAAAATTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841955 |
| Trichome-related Gene from Literature | N/A |