Detail of EST/Unigene AW560625 |
Acc. | AW560625 |
Internal Acc. | EST315673 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=8e-13; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=3e-12; Beta-fructofuranosidase, cell wall isozyme OS=Zea mays E-value=2e-11; Beta-fructofuranosidase, insoluble isoenzyme 4 OS=Oryza sativa subsp. japonica E-value=3e-11; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=5e-11; |
Length | 374 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | AATAATTATTTGTTACTTATCAATTATTGAATGAATGTTGACTTATCAATCCAAAATTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841955 |
Trichome-related Gene from Literature | N/A |