| Detail of EST/Unigene AW560648 |
| Acc. | AW560648 |
| Internal Acc. | EST315696 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=2e-42; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=4e-34; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=4e-24; Cytochrome P450 93A2 OS=Glycine max E-value=2e-18; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=2e-18; |
| Length | 529 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | CAAAAGGAAATTACATCCATCATTTTATTCTAAATAACTACGATCCACAGTCCACAAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829889 |
| Trichome-related Gene from Literature | N/A |