Detail of EST/Unigene AW560648 |
Acc. | AW560648 |
Internal Acc. | EST315696 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=2e-42; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=4e-34; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=4e-24; Cytochrome P450 93A2 OS=Glycine max E-value=2e-18; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=2e-18; |
Length | 529 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | CAAAAGGAAATTACATCCATCATTTTATTCTAAATAACTACGATCCACAGTCCACAAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829889 |
Trichome-related Gene from Literature | N/A |