| Detail of EST/Unigene AW560652 |
| Acc. | AW560652 |
| Internal Acc. | EST315700 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Prunus persica E-value=8e-48; Superoxide dismutase [Mn], mitochondrial OS=Nicotiana plumbaginifolia E-value=3e-46; Superoxide dismutase [Mn], mitochondrial OS=Capsicum annuum E-value=6e-46; Superoxide dismutase [Mn], mitochondrial OS=Hevea brasiliensis E-value=1e-45; Superoxide dismutase [Mn] 3.1, mitochondrial OS=Zea mays E-value=5e-45; |
| Length | 580 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | CGCACAAGATTCTCATTCAAACAAAGTAGTAAACCCTAGAAGCAAAAAATAAAATCTTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.15.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820263 |
| Trichome-related Gene from Literature | N/A |