Detail of EST/Unigene AW560812 |
Acc. | AW560812 |
Internal Acc. | EST315860 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-arabinopyranose mutase 1 OS=Arabidopsis thaliana E-value=8e-30; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=1e-29; UDP-arabinopyranose mutase 2 OS=Arabidopsis thaliana E-value=2e-29; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=3e-29; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=3e-29; |
Length | 190 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | TGCATGTCGTTGCTTTGGTTATATGGTTTCTAAGAAGAAGTATATCTATACCATTGATGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821233 |
Trichome-related Gene from Literature | N/A |