| Detail of EST/Unigene AW561006 |
| Acc. | AW561006 |
| Internal Acc. | EST316054 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 704C1 OS=Pinus taeda E-value=5e-56; Cytochrome P450 94A1 OS=Vicia sativa E-value=2e-36; Cytochrome P450 86A2 OS=Arabidopsis thaliana E-value=6e-36; Cytochrome P450 94A2 OS=Vicia sativa E-value=4e-34; Cytochrome P450 86B1 OS=Arabidopsis thaliana E-value=6e-33; |
| Length | 684 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | ATTTGGAACTGAAATTGACAGCATGTGTGGAACAAGTGAAGAAGGGAAGATTTTTGCCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819098 |
| Trichome-related Gene from Literature | N/A |