Detail of EST/Unigene AW561087 |
Acc. | AW561087 |
Internal Acc. | EST316135 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=2e-62; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=6e-45; Cullin-2 OS=Arabidopsis thaliana E-value=6e-42; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=2e-38; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=5e-30; |
Length | 445 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | GTTAGGCAACAATGGCACCGGAAAGTAATTGATTTTGATCAAGGTTGGGCCTACATGGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03869 cullin 3; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10609 cullin 4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10609 cullin 4 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825648 |
Trichome-related Gene from Literature | N/A |