| Detail of EST/Unigene AW561087 |
| Acc. | AW561087 |
| Internal Acc. | EST316135 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=2e-62; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=6e-45; Cullin-2 OS=Arabidopsis thaliana E-value=6e-42; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=2e-38; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=5e-30; |
| Length | 445 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR; |
| Sequence | GTTAGGCAACAATGGCACCGGAAAGTAATTGATTTTGATCAAGGTTGGGCCTACATGGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03869 cullin 3; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10609 cullin 4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10609 cullin 4 |
| EC | 6.3.2.19 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825648 |
| Trichome-related Gene from Literature | N/A |