| Detail of EST/Unigene AW573665 |
| Acc. | AW573665 |
| Internal Acc. | EST316256 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RAC2 OS=Lotus japonicus E-value=8e-68; Rac-like GTP-binding protein RAC13 OS=Gossypium hirsutum E-value=9e-64; Rac-like GTP-binding protein ARAC2 OS=Arabidopsis thaliana E-value=2e-63; Rac-like GTP-binding protein 7 OS=Oryza sativa subsp. japonica E-value=3e-63; Rac-like GTP-binding protein 5 OS=Oryza sativa subsp. japonica E-value=4e-63; |
| Length | 533 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | TCTCATTTATTCNCAAGTGAAGGAAATATAATAGAAGCATGCAGTGATGGAAACAATAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
|
| Corresponding NCBI Gene | 834637 |
| Trichome-related Gene from Literature | N/A |