Detail of EST/Unigene AW573716 |
Acc. | AW573716 |
Internal Acc. | EST316307 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--tRNA ligase, chloroplastic/mitochondrial OS=Nicotiana tabacum E-value=3e-55; Glutamate--tRNA ligase, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=8e-55; Glutamate--tRNA ligase, chloroplastic/mitochondrial OS=Hordeum vulgare E-value=7e-52; Glutamate--tRNA ligase OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=2e-34; Glutamate--tRNA ligase OS=Moorella thermoacetica (strain ATCC 39073) E-value=9e-34; |
Length | 393 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | CAATGATGCTACCATGGCTATTTCTCATGTTATTTAGATTTGAGGAGCATTTACCAAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
EC | 6.1.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836526 |
Trichome-related Gene from Literature | N/A |