| Detail of EST/Unigene AW574075 |
| Acc. | AW574075 |
| Internal Acc. | EST316666 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase kinase 2 OS=Arabidopsis thaliana E-value=1e-58; Phosphoenolpyruvate carboxylase kinase 1 OS=Arabidopsis thaliana E-value=5e-58; Calcium-dependent protein kinase 7 OS=Arabidopsis thaliana E-value=3e-41; Calcium-dependent protein kinase 8 OS=Arabidopsis thaliana E-value=1e-40; Calcium-dependent protein kinase 14 OS=Arabidopsis thaliana E-value=3e-40; |
| Length | 590 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | CTAAGTACCAACTCAGCGAGGAGATCGGTCGTGGTCGTTTCGGTACCATTTTCCGGTGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
| EC | 2.7.11.17 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 819609 |
| Trichome-related Gene from Literature | N/A |