| Detail of EST/Unigene AW574079 |
| Acc. | AW574079 |
| Internal Acc. | EST316670 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 78A3 OS=Glycine max E-value=9e-55; Cytochrome P450 78A4 OS=Pinus radiata E-value=3e-38; Cytochrome P450 78A1 OS=Zea mays E-value=2e-30; Cytochrome P450 78A11 OS=Oryza sativa subsp. japonica E-value=2e-30; Cytochrome P450 98A2 OS=Glycine max E-value=2e-16; |
| Length | 469 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | CTGCTTTTGGACAGAGGTTTAAGATTGATGAAGTTAATGAGAGAATGATGGAACTTAGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00490 cytochrome P450, family 4, subfamily F (leukotriene-B4 20-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.13.30 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825361 |
| Trichome-related Gene from Literature | N/A |