| Detail of EST/Unigene AW574201 |
| Acc. | AW574201 |
| Internal Acc. | EST316792 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Pisum sativum E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Manihot esculenta E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Antirrhinum majus E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Solanum tuberosum E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Ipomoea batatas E-value=0; |
| Length | 691 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | GATTATAAAGATCATCAACTTAGATTCAGCTAGTTATGTCAGGCCGCACTTGAAGCATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840184 |
| Trichome-related Gene from Literature | N/A |