Detail of EST/Unigene AW618735 |
Acc. | AW618735 |
Internal Acc. | EST320721 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=1e-55; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=7e-55; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=9e-55; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=4e-54; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=6e-54; |
Length | 403 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SP_TRI (1 ESTs); |
Sequence | CCTCTGTCAAAAATGGCTGATCTGAAGAAGAAATTTTTGGATGTGTACTCTGTTCTTAAA |
EST members of Unigene | AW618735 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |