| Detail of EST/Unigene AW649445 |
| Acc. | AW649445 |
| Internal Acc. | EST327899 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | NEDD8-activating enzyme E1 regulatory subunit OS=Arabidopsis thaliana E-value=1e-32; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=2e-23; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=2e-20; Glucan endo-1,3-beta-glucosidase, basic isoform 1 (Fragment) OS=Solanum tuberosum E-value=2e-20; Glucan endo-1,3-beta-glucosidase, basic isoform 3 (Fragment) OS=Solanum tuberosum E-value=5e-20; |
| Length | 532 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_germ_seedlings_TAMU (1 ESTs); |
| Sequence | AAAAGTTCCCCCTACGAATTTATTTGGTGTTGCATACAAACATAAAATTGCATGAAGATA |
| EST members of Unigene | AW649445 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839286 |
| Trichome-related Gene from Literature | 839286 |