Detail of EST/Unigene AW683206 |
Acc. | AW683206 |
Internal Acc. | NF008H09LF1F1079 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=3e-62; Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=2e-61; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=1e-58; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=1e-20; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=2e-18; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CTTATTACGCCAAGCTCGAAATTATTCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
EST members of Unigene | AW683206 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1609.1.S1_at
|
Corresponding NCBI Gene | 838151 |
Trichome-related Gene from Literature | N/A |