Detail of EST/Unigene AW683309 |
Acc. | AW683309 |
Internal Acc. | NF010D07LF1F1061 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-33; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-29; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-16; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-13; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | AW683309 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.46540.1.S1_at
|
Corresponding NCBI Gene | 825414 |
Trichome-related Gene from Literature | N/A |