Detail of EST/Unigene AW685899 |
Acc. | AW685899 |
Internal Acc. | NF031E10NR1F1000 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain 1A, chloroplastic OS=Arabidopsis thaliana E-value=9e-38; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Marchantia paleacea E-value=2e-37; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=4e-37; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Malus sp. E-value=4e-37; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Betula pendula E-value=5e-37; |
Length | 674 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT (1 ESTs); |
Sequence | ATTCCTTTCTTCCTTTCATCTTAACTATTCTGCCTCCTTCAAAGATCAGACATTTATTTG |
EST members of Unigene | AW685899 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |