Detail of EST/Unigene AW687083 |
Acc. | AW687083 |
Internal Acc. | NF005G10RT1F1083 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK2 OS=Medicago sativa E-value=2e-34; Mitogen-activated protein kinase 6 OS=Oryza sativa subsp. japonica E-value=8e-32; Mitogen-activated protein kinase 4 OS=Arabidopsis thaliana E-value=1e-30; Mitogen-activated protein kinase 11 OS=Arabidopsis thaliana E-value=5e-29; Mitogen-activated protein kinase 2 OS=Oryza sativa subsp. japonica E-value=8e-29; |
Length | 369 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT (1 ESTs); |
Sequence | CGGCACGAGGATGTCTCCTGGTGCTGTTGATTTGTTAGAGAGGATGCTTGTTTTTGATCC |
EST members of Unigene | AW687083 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
EC | 2.7.11.1 2.7.11.24 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5102.1.S1_at
|
Corresponding NCBI Gene | 828151 |
Trichome-related Gene from Literature | N/A |