Detail of EST/Unigene AW688762 |
Acc. | AW688762 |
Internal Acc. | NF011D01ST1F1000 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Lon protease homolog 1, mitochondrial OS=Arabidopsis thaliana E-value=6e-63; Lon protease homolog, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-58; Lon protease homolog, mitochondrial OS=Oryza sativa subsp. indica E-value=1e-58; Lon protease homolog, mitochondrial OS=Zea mays E-value=9e-57; Lon protease homolog 4, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=2e-55; |
Length | 557 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | TGAAGCTAAAGCGGCTGAGGAGACTCCGTCAAAGGCTGCTTCTTCTGCTATTGTCTCCAC |
EST members of Unigene | AW688762 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.21.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32335.1.S1_at
|
Corresponding NCBI Gene | 832744 |
Trichome-related Gene from Literature | N/A |