Detail of EST/Unigene AW689615 |
Acc. | AW689615 |
Internal Acc. | NF022D03ST1F1000 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-39; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=2e-20; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=1e-19; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-16; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=5e-16; |
Length | 662 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | GGTTGATGCTGTACATTCTGCTTTAAGTGGAATGGGATTCCAAGACATAGAAATTGTGGT |
EST members of Unigene | AW689615 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32373.1.S1_at
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |