| Detail of EST/Unigene AW690491 |
| Acc. | AW690491 |
| Internal Acc. | NF035B04ST1F1000 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=1e-58; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=3e-52; Beta-glucosidase 8 OS=Arabidopsis thaliana E-value=1e-44; Beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-44; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-43; |
| Length | 570 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
| Sequence | CACTTCTAAAAAATGGAACACGGAAATGTTTGAGGAATATAGAGAAAGAAAAAAAAAACA |
| EST members of Unigene | AW690491 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5178.1.S1_at, Mtr.5178.1.S1_s_at
|
| Corresponding NCBI Gene | 839435 |
| Trichome-related Gene from Literature | N/A |