Detail of EST/Unigene AW691944 |
Acc. | AW691944 |
Internal Acc. | NF050H11ST1F1000 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 1 OS=Mus musculus E-value=1e-26; Replication factor C subunit 1 OS=Homo sapiens E-value=3e-25; Replication factor C subunit 1 OS=Drosophila melanogaster E-value=8e-22; Probable replication factor C subunit 1 OS=Dictyostelium discoideum E-value=6e-19; Replication factor C subunit 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-17; |
Length | 464 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | AAAAGATCCTCCACACAAGGGAGAAAAGGAAGTCCCTGAAGGTGCTCCTAACTGTTTAGC |
EST members of Unigene | AW691944 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10754 replication factor C subunit 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10754 replication factor C subunit 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10754 replication factor C subunit 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32453.1.S1_at
|
Corresponding NCBI Gene | 832261 |
Trichome-related Gene from Literature | N/A |