| Detail of EST/Unigene AW692010 |
| Acc. | AW692010 |
| Internal Acc. | NF051D05ST1F1000 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable carotenoid cleavage dioxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=4e-39; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=3e-16; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=1e-15; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=1e-14; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=1e-14; |
| Length | 653 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
| Sequence | CCAAGATCCACTTTACTTTATCAACATGGTTCCCAAACCCATAATAATATTAACAACTAA |
| EST members of Unigene | AW692010 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.14675.1.S1_s_at
|
| Corresponding NCBI Gene | 827655 |
| Trichome-related Gene from Literature | N/A |